View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21310_low_9 (Length: 215)
Name: NF21310_low_9
Description: NF21310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21310_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 40 - 193
Target Start/End: Complemental strand, 31027357 - 31027204
Alignment:
| Q |
40 |
cataggagcgacattattatgatttgtaaataaaatcatacacttggtaaacaaatataattaactttcaacttcagttgaaatggttatacatatacat |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31027357 |
cataggagcgacattattatgatttgtaaataaaatcatacacttggtaaacaaatataattaactttcaacttcagttgaaatggttatacatatacat |
31027258 |
T |
|
| Q |
140 |
tgaccatcacgagtacaatgatcaatcataggaggaagacacaaaccaatacaa |
193 |
Q |
| |
|
|||||| | ||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
31027257 |
tgaccacgaagagtacaatgatctatcataggaggaagacacaaaccaaaacaa |
31027204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University