View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21311_high_5 (Length: 201)
Name: NF21311_high_5
Description: NF21311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21311_high_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 4e-80; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 16 - 191
Target Start/End: Complemental strand, 23587269 - 23587088
Alignment:
| Q |
16 |
cacaaccattcttaccaaatactgaagcaatacaattcccttttctactattatgctctgatgagcatga------ataaaattgtttatcgcccaacca |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
23587269 |
cacaaccattcttaccaaatactgaagcaatacaattcccttttctactattatgctctgatgagcatgagcatgaataaaattgtttatcgcccaacca |
23587170 |
T |
|
| Q |
110 |
atgcaaaaccatgatcaacactctcactattataaacaataaaattcactttcctattattatgtatatgcagaataattta |
191 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
23587169 |
atgcaaaactatgatcaacactctcactattataaacaataaaattcactttcctattattatgtttatgcagaataattta |
23587088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 109 - 162
Target Start/End: Complemental strand, 23596059 - 23596006
Alignment:
| Q |
109 |
aatgcaaaaccatgatcaacactctcactattataaacaataaaattcactttc |
162 |
Q |
| |
|
||||||||||||| ||||||| ||| || || |||||||||||||||||||||| |
|
|
| T |
23596059 |
aatgcaaaaccattatcaacaatcttacaatcataaacaataaaattcactttc |
23596006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University