View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21311_low_6 (Length: 201)

Name: NF21311_low_6
Description: NF21311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21311_low_6
NF21311_low_6
[»] chr4 (2 HSPs)
chr4 (16-191)||(23587088-23587269)
chr4 (109-162)||(23596006-23596059)


Alignment Details
Target: chr4 (Bit Score: 151; Significance: 4e-80; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 16 - 191
Target Start/End: Complemental strand, 23587269 - 23587088
Alignment:
16 cacaaccattcttaccaaatactgaagcaatacaattcccttttctactattatgctctgatgagcatga------ataaaattgtttatcgcccaacca 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||      ||||||||||||||||||||||||    
23587269 cacaaccattcttaccaaatactgaagcaatacaattcccttttctactattatgctctgatgagcatgagcatgaataaaattgtttatcgcccaacca 23587170  T
110 atgcaaaaccatgatcaacactctcactattataaacaataaaattcactttcctattattatgtatatgcagaataattta 191  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
23587169 atgcaaaactatgatcaacactctcactattataaacaataaaattcactttcctattattatgtttatgcagaataattta 23587088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 109 - 162
Target Start/End: Complemental strand, 23596059 - 23596006
Alignment:
109 aatgcaaaaccatgatcaacactctcactattataaacaataaaattcactttc 162  Q
    ||||||||||||| ||||||| ||| || || ||||||||||||||||||||||    
23596059 aatgcaaaaccattatcaacaatcttacaatcataaacaataaaattcactttc 23596006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University