View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21313_high_4 (Length: 240)
Name: NF21313_high_4
Description: NF21313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21313_high_4 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 97 - 240
Target Start/End: Complemental strand, 38841495 - 38841352
Alignment:
| Q |
97 |
aatagataacttttacaatatagagtatgaaataaatatgttatattccataaaataaagttatgtcattaaatctgttataaaatatcccaaaactaga |
196 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38841495 |
aatagataacttttacaatttagagtatgaaataaatatgttatattccataaaataaagttatgtcattaaatctgttataaaatatcccaaaactaga |
38841396 |
T |
 |
| Q |
197 |
acaannnnnnnnncttcattttattgtttactaattaatttttt |
240 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
38841395 |
acaattttttttttttcattttattgtttactaattaatttttt |
38841352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 18 - 74
Target Start/End: Complemental strand, 38841575 - 38841519
Alignment:
| Q |
18 |
ataaaactcagtttagattatttgaaattcaaaaaatatgttaagtatattaattaa |
74 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38841575 |
ataaaactcagtttagattatttgaaattcaaaaaatatgttaagtatattaattaa |
38841519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University