View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21313_low_5 (Length: 240)

Name: NF21313_low_5
Description: NF21313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21313_low_5
NF21313_low_5
[»] chr7 (2 HSPs)
chr7 (97-240)||(38841352-38841495)
chr7 (18-74)||(38841519-38841575)


Alignment Details
Target: chr7 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 97 - 240
Target Start/End: Complemental strand, 38841495 - 38841352
Alignment:
97 aatagataacttttacaatatagagtatgaaataaatatgttatattccataaaataaagttatgtcattaaatctgttataaaatatcccaaaactaga 196  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38841495 aatagataacttttacaatttagagtatgaaataaatatgttatattccataaaataaagttatgtcattaaatctgttataaaatatcccaaaactaga 38841396  T
197 acaannnnnnnnncttcattttattgtttactaattaatttttt 240  Q
    ||||          ||||||||||||||||||||||||||||||    
38841395 acaattttttttttttcattttattgtttactaattaatttttt 38841352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 18 - 74
Target Start/End: Complemental strand, 38841575 - 38841519
Alignment:
18 ataaaactcagtttagattatttgaaattcaaaaaatatgttaagtatattaattaa 74  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38841575 ataaaactcagtttagattatttgaaattcaaaaaatatgttaagtatattaattaa 38841519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University