View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21314_high_8 (Length: 360)
Name: NF21314_high_8
Description: NF21314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21314_high_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 314; Significance: 1e-177; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 2 - 344
Target Start/End: Original strand, 32236023 - 32236364
Alignment:
| Q |
2 |
cttgggcgtgttggctctacaatgttctcccctgtgccctcttaattagtatgttccactatggattgggtctgagaaaatggaggacaaaaacacagcg |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32236023 |
cttgggcgtgttggctctacaatgttctcccctgtgccctcttaattagtatgttccactatggattgggtctgagaaaatggaggacaaaaacacagcg |
32236122 |
T |
|
| Q |
102 |
gaactgcaaaagaagatccttgttttgcttgatgggtcctatatggatttacttatacccttttagttttatgttgttggttatgaaatttcaactatat |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32236123 |
gaactgcaaaagaagatccttgttttgcttgatgggtcctatatggatttacttatacccttttagttttatgttgttggttatgaaatttcaactatat |
32236222 |
T |
|
| Q |
202 |
taattcaaattgatatatgtagctagctttacatgaaaagtaagaagnnnnnnnncataaaaattagggttcaccaaagccttcaacttcactctccact |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32236223 |
taattcaaattgatatatgtagctagctttacatgaaaagtaagaag-aaaaaaacataaaaattagggttcaccaaagccttcaacttcactctccact |
32236321 |
T |
|
| Q |
302 |
gttttgtatagagtgtgaatcacaatgcctacactttttcaag |
344 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32236322 |
gttttgtatagagtgtgaatcacaatgcctacactttttcaag |
32236364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University