View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21314_low_13 (Length: 288)
Name: NF21314_low_13
Description: NF21314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21314_low_13 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 6 - 288
Target Start/End: Original strand, 55736852 - 55737134
Alignment:
| Q |
6 |
atttccgaccaaggtttataattggttgtgaatgatatgatgtttgaaggtgacatcagtgttttgtggggaaccgttgaatccagcgctattgttattg |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55736852 |
atttccgaccaaggtttataattggttgtgaatgatatgatgtttgaaggtgacatcagtgttttgtggggaaccgttgaatccagcgctattgttattg |
55736951 |
T |
 |
| Q |
106 |
ggtctatgtggcacgtcattctttgtgagtatgtggatgcacaacgtggcagctgccgtgatgttgatgccggtggccacagggctgctacagcggctgc |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
55736952 |
ggtctatgtggcacgtcattctttgtgagtatgtggatgcacaacgtggcagctgccgtgatgttgatgccggtggccacagggctgctacagaggctgc |
55737051 |
T |
 |
| Q |
206 |
caccaccgtcagagcaatcggagttggtgaataagttcagcagagcggtggttctgacagtggtttatgcggttccaattgga |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55737052 |
caccaccgtcagagcaatcggagttggtgaataagttcagcagagcggtggttctgacagtggtttatgcggttccaattgga |
55737134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University