View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21314_low_17 (Length: 243)
Name: NF21314_low_17
Description: NF21314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21314_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 17 - 230
Target Start/End: Complemental strand, 49031989 - 49031776
Alignment:
| Q |
17 |
aataagctcatataacccaattcaaacaagtgctgcgacaaaatgaaatataaggaaaaggctcttacagcagcaccagagcgaacagagacgaggagag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49031989 |
aataagctcatataacccaattcaaacaagtgctgcgacaaaatgaaatataaggaaaaggctcttacagcagcaccagagcgaacagagacgaggagag |
49031890 |
T |
|
| Q |
117 |
gttttgaaggattcccaagaaaggcccccatttcattttgcacaaaattaaggccttcaagtatctcctcccacaaaccatttggtaggttctttacatt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49031889 |
gttttgaaggattcccaagaaaggcccccatttcattttgcacaaaattaaggccttcaagtatctcctcccacaaaccatttggtaggttctttacatt |
49031790 |
T |
|
| Q |
217 |
ttcttgatattctt |
230 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
49031789 |
ttcttgatattctt |
49031776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University