View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21315_high_13 (Length: 321)
Name: NF21315_high_13
Description: NF21315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21315_high_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 1 - 305
Target Start/End: Original strand, 32753953 - 32754253
Alignment:
| Q |
1 |
aaattaaatgaaattaaaaaactctgataaaacggcgtcatttagcactaacatattttctctctgtctttgtcttcaaacttgaaacttgaacagtgga |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||| ||||| |
|
|
| T |
32753953 |
aaattaaatgaaattaaaaaactctgaaaaaacggcgtcatttagcactaacatattttctct--gtct--gtcttcaaacttgaaacttgaacggtgga |
32754048 |
T |
 |
| Q |
101 |
agcttaaaccctgattttgaagattgcacgttgtggcggcgaatccatgaagaaatccaatcaaacccagatgaaccctaattgggttcaactcaaacaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
32754049 |
agcttaaaccctgattttgaagattgcacgttgtggcggcgaatccatgaagaaatccaatcaaaaccaaatgaaccctaattgggttcaactcaaacaa |
32754148 |
T |
 |
| Q |
201 |
gtattccctctattcttcttcttctctttcatctatacacacagattcttatctttattgctgtttaaccttttgcagaagctgaatcttaatggcccaa |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32754149 |
gtattccctctattcttcttcttctctttcatctatacacacatattcttatctttattgctgtttaaccttttgcagaagctgaatcttaatggcccaa |
32754248 |
T |
 |
| Q |
301 |
aagct |
305 |
Q |
| |
|
||||| |
|
|
| T |
32754249 |
aagct |
32754253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University