View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21315_high_14 (Length: 318)
Name: NF21315_high_14
Description: NF21315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21315_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 1 - 313
Target Start/End: Complemental strand, 54733369 - 54733057
Alignment:
| Q |
1 |
aattcgtcgctgctcattccatcttcgggatataaactccattttttctctttatcaacttcaatgtttttcctcttactcttatcattatcactctcac |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54733369 |
aattcgtcgctgctcattccatcttcaggatataaactccattttttctctttatcaacttcaatgtttttcctcttactcttatcattatcactctcac |
54733270 |
T |
 |
| Q |
101 |
acctttgcaacactctttgatccttcgcatcatcactattcacacccctcaccaactcaatttccgattgacacctcctatatcccttcacttccaaacc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54733269 |
acctttgcaacactctttgatccttcgcatcatcactattcacacccctcaccaactcaatttccgattgacacctcctatatcccttcacttccaaacc |
54733170 |
T |
 |
| Q |
201 |
catctctgtttttatctcctgtttctcttccaacttcattttgttatcatcttcactctttatactctctttttcagagaatttcaccatgcatccatcg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
54733169 |
catctctgtttttatctcctgtttctcttccaacttcattttgttatcatcttcactctttatactctctttttgagagaatttcaccatgcatccatcg |
54733070 |
T |
 |
| Q |
301 |
tatattcttcgac |
313 |
Q |
| |
|
| |||||| |||| |
|
|
| T |
54733069 |
tttattctacgac |
54733057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University