View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21315_low_16 (Length: 317)
Name: NF21315_low_16
Description: NF21315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21315_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 8e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 8e-95
Query Start/End: Original strand, 19 - 297
Target Start/End: Original strand, 9402503 - 9402785
Alignment:
| Q |
19 |
ggttgaacacacataattgacacaaatacagtacatctacattgttaaccgtataaagtatttacggtgtgcaatacnnnnnnnnnnnnnnnnnnnaaat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9402503 |
ggttgaacacacataattgacacaaatacagtacatctacattgttaaccgtataaagtatttacggtgtgcaatacttttttacttttattttttaaat |
9402602 |
T |
 |
| Q |
119 |
atagaggagaacttttatcacacaaaaattgagtggcgtaattaactaatttgactacttttccttcnnnnnnn----ctaatttgactactttattaat |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9402603 |
atagaggagaacttttatcacacaaaaattgagtggcgtaattaactaatttgactacttttccttcaaaaaaaaaaactaatttgactactttattaat |
9402702 |
T |
 |
| Q |
215 |
cgttaaattgcatattattaaccacatttctagcatgaatagaaataaaaatctaaatctagtttggacgtcgttgcttcccc |
297 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
9402703 |
cgttaaattgtatattattaaccacatttttagcatgaatagaaataaaaatctaaatctagtttggatgtcgttgcttcccc |
9402785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University