View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21316_low_6 (Length: 256)
Name: NF21316_low_6
Description: NF21316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21316_low_6 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 8 - 239
Target Start/End: Original strand, 29522432 - 29522664
Alignment:
| Q |
8 |
tccaccgaagaactcgcctatctttcatttaaactatcatacatagaattctatcattctttatttg-tcaaataactgaattttcttaacaaattagtg |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | |||||||||||||||||||||||||||||| |
|
|
| T |
29522432 |
tccaccgaagaactcgcctatctttcatttaaactatcatacatagaattctatcattctttattcgataaaataactgaattttcttaacaaattagtg |
29522531 |
T |
|
| Q |
107 |
tgtgcatctactctatttgcaataatatatgtatgaataaaagcatgtgacttcacattgattagtcttgttgagcagggatgctggcagtgaattggaa |
206 |
Q |
| |
|
| ||||||||||||||||||||||||||| ||||||||||||||||||||||| | ||||| || | | ||||||||||||||||||||||||||||||| |
|
|
| T |
29522532 |
tatgcatctactctatttgcaataatataggtatgaataaaagcatgtgactttatattgaatactgtggttgagcagggatgctggcagtgaattggaa |
29522631 |
T |
|
| Q |
207 |
cttattgagaggattgtgaaagaggtctctagg |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
29522632 |
cttattgagaggattgtgaaagaggtctctagg |
29522664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University