View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21317_high_16 (Length: 217)
Name: NF21317_high_16
Description: NF21317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21317_high_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 18 - 194
Target Start/End: Original strand, 30477819 - 30477991
Alignment:
| Q |
18 |
aatacaacatggacacattaataattgggtcctcagcagaccccatatcaaagaaattcgcataccccacaacacggatggttccaaaatgttattctgt |
117 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30477819 |
aatacaacaaggacacattaataattgggtcctcagcagaccccatatcaaagaaattcgcataccccacaacacggatggttccaaaatgttattctgt |
30477918 |
T |
 |
| Q |
118 |
gagagaaaatgaagcatatcggaagttttatatatgattggcattaattaaattctaggaaatatttttgatactta |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
30477919 |
gagagaaaatgaagcatatcggaagttttatatatgattggc----attaaattctaggaaatatttttgatactta |
30477991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University