View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21317_low_18 (Length: 220)
Name: NF21317_low_18
Description: NF21317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21317_low_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 6315065 - 6314855
Alignment:
| Q |
1 |
aaaaataaactctgcacatgatgaaaatgtcccctgcatgcgtttgaatttgaggtcataggtcactattcccctaagctgttgtagtttcttgccattc |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
6315065 |
aaaaataaattctgcacatgatgaaaatgtcccctgcatgcgtttgaatttgaggtcataggttactattcccctaagctgttgtagtctcttgccattc |
6314966 |
T |
|
| Q |
101 |
aaagaagatatgccttaggaggtgctgtgtgtaggaagggaaagagtgacttctgtccctttttgcaatccacttgtgtgcttttaattccctaacggtc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
6314965 |
aaagaagatatgccttaggaggtgctgtgtgtaggaagggaaagagtgacttctggccctttttgcaatccacttgtgtgcttttaattccctaacagtc |
6314866 |
T |
|
| Q |
201 |
acaggttctgc |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
6314865 |
acaggttctgc |
6314855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University