View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21319_high_32 (Length: 284)

Name: NF21319_high_32
Description: NF21319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21319_high_32
NF21319_high_32
[»] chr5 (2 HSPs)
chr5 (2-277)||(28341420-28341707)
chr5 (46-160)||(28382066-28382177)


Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 2 - 277
Target Start/End: Complemental strand, 28341707 - 28341420
Alignment:
2 gaaaccggttcaggaaccaaacccggttcaggaaattgaactccacaggaacaaaacgaaccgggaggtgcttcttgaaccggatcctcagcagcagcag 101  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| ||||||||||||||||||||||||    
28341707 gaaagcggttcaggaaccaaacccggttcaggaaattgaactccacaggaacaaaacgaaccaggaggagcttctggaaccggatcctcagcagcagcag 28341608  T
102 gttc------------atcagtaactaacgaaatcactttctcagcgttttcttcagggcaaacttcaacatcgccgttttctccgtcaacttttgcttc 189  Q
    ||||            ||||||||||||||||||||||||||| ||||||||||| ||| ||||||||||||||||||||||||||||||||||  ||||    
28341607 gttcttcagcaggttcatcagtaactaacgaaatcactttctctgcgttttcttcggggtaaacttcaacatcgccgttttctccgtcaactttcacttc 28341508  T
190 ctgttcatccttcacagattccaccttctgaatttcctgaatcttggtttcgacaaccatctccggcccacaattcgtatcctttgct 277  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28341507 ctgttcatccatcacagattccaccttctgaatttcctgaatcttggtttcgacaaccatctccggcccacaattcgtatcctttgct 28341420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 46 - 160
Target Start/End: Original strand, 28382066 - 28382177
Alignment:
46 acaggaacaaaacgaaccgggaggtgcttcttgaaccggatcctcagcagcagcaggttcatcagtaactaacgaaatcactttctcagcgttttcttca 145  Q
    |||||||||| | ||||||||  |  |||||||||||||||||||||||| ||   |||||  ||||||||||| ||||||| | || ||||||||||||    
28382066 acaggaacaatatgaaccgggttgaacttcttgaaccggatcctcagcagaag---gttcactagtaactaacggaatcactctttccgcgttttcttca 28382162  T
146 gggcaaacttcaaca 160  Q
    | | |||| ||||||    
28382163 gaggaaacatcaaca 28382177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University