View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21319_high_46 (Length: 203)
Name: NF21319_high_46
Description: NF21319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21319_high_46 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 61; Significance: 2e-26; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 72 - 136
Target Start/End: Complemental strand, 19405118 - 19405054
Alignment:
| Q |
72 |
atgagaaaatgttaactagcaatagtgattgactttaggactcatttggaggccataataagaga |
136 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
19405118 |
atgagaaaatgttaactagcaatagtgatcgactttaggactcatttggaggccataataagaga |
19405054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 72 - 141
Target Start/End: Complemental strand, 17947601 - 17947532
Alignment:
| Q |
72 |
atgagaaaatgttaactagcaatagtgattgactttaggactcatttggaggccataataagagagatga |
141 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||||||||||||| || |||| ||||||||| |||| |
|
|
| T |
17947601 |
atgacaaaatgttaaccagcaatagtgattgactttaggactcatttagaagccaaaataagagatatga |
17947532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 88 - 131
Target Start/End: Complemental strand, 18018999 - 18018956
Alignment:
| Q |
88 |
tagcaatagtgattgactttaggactcatttggaggccataata |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18018999 |
tagcaatagtgattgactttaggactcatttggaggccataata |
18018956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 72 - 122
Target Start/End: Complemental strand, 19417287 - 19417233
Alignment:
| Q |
72 |
atgagaaaatgttaactagcaatagtg----attgactttaggactcatttggag |
122 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
19417287 |
atgagaaaatgttaactagcaatagtgtttaattgactttaggactcatttggag |
19417233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University