View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21319_low_19 (Length: 346)
Name: NF21319_low_19
Description: NF21319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21319_low_19 |
 |  |
|
| [»] scaffold0120 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0120 (Bit Score: 109; Significance: 9e-55; HSPs: 1)
Name: scaffold0120
Description:
Target: scaffold0120; HSP #1
Raw Score: 109; E-Value: 9e-55
Query Start/End: Original strand, 167 - 336
Target Start/End: Complemental strand, 3123 - 2959
Alignment:
| Q |
167 |
ttgatttggcaacgtttcttacctttacattcctcagcccgcgatattttgaaccaaacctaacaaaagctatacatccaaaaacaatcaagagcgaaaa |
266 |
Q |
| |
|
|||| |||||||| |||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
3123 |
ttgaattggcaacatttcttacctttacattcatcagcccttgatattttgaaccaaacctaacaaaagctatgcatccaaaaacaatcaagagagaaaa |
3024 |
T |
 |
| Q |
267 |
gaaaggaagagccagccaaccctttagcaacaaaaacataaaaataccccttctacgtccaattatcatt |
336 |
Q |
| |
|
||| ||||| |||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3023 |
gaacggaag----agccaaccctctagcaac-aaaacataaaaataccccttctacgtccaattatcatt |
2959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University