View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21319_low_31 (Length: 302)
Name: NF21319_low_31
Description: NF21319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21319_low_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 229; Significance: 1e-126; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 295
Target Start/End: Complemental strand, 54267084 - 54266779
Alignment:
| Q |
1 |
aattcttgtcccacaaatgagcttcatatcggcctgtccaacggtgcctgaccgatggtaacannnnnnnnn-----------aataacaaatgttagtg |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
54267084 |
aattcttgtcccacaaatgagcttcatatcggcctgtccaacggtgcctgaccgatggtaacatttttttttttattttttttaataacaaatgttagtg |
54266985 |
T |
 |
| Q |
90 |
tgtcaaatgctaatccgacacgagagatagataagcatatacaagaggaaataaacaatcaaggcgatatgatcgagcaaatcacctagtgactcctctg |
189 |
Q |
| |
|
||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54266984 |
tgttaaatgctaatccgacacgagagatagataaacatatacaagaggaaataaacaatcaaggcgatatgatcgagcaaatcacctagtgactcctctg |
54266885 |
T |
 |
| Q |
190 |
tatattgagctgcgttgaggtggagaagttctagggacacttttcctcgtccgttttgctttggtggtgacagtgttacttggattcagattatcagtat |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
54266884 |
tatattgagctgcgttgaggtggagaagttctagggacacttttcctcgtccgttttgctttggtggtgacagtgttacttggattcagattatcattat |
54266785 |
T |
 |
| Q |
290 |
cattgc |
295 |
Q |
| |
|
|||||| |
|
|
| T |
54266784 |
cattgc |
54266779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 1229030 - 1228988
Alignment:
| Q |
1 |
aattcttgtcccacaaatgagcttcatatcggcctgtccaacg |
43 |
Q |
| |
|
||||||| ||||||||||||||||||||||| || |||||||| |
|
|
| T |
1229030 |
aattcttatcccacaaatgagcttcatatcgaccggtccaacg |
1228988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000003; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 40
Target Start/End: Complemental strand, 25049817 - 25049778
Alignment:
| Q |
1 |
aattcttgtcccacaaatgagcttcatatcggcctgtcca |
40 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
25049817 |
aattcttgtcccacaaatgagcttcataccggcctgtcca |
25049778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 173 - 236
Target Start/End: Complemental strand, 25049684 - 25049621
Alignment:
| Q |
173 |
acctagtgactcctctgtatattgagctgcgttgaggtggagaagttctagggacacttttcct |
236 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||| ||||||| ||| ||||||||| |||| |
|
|
| T |
25049684 |
acctagtgactcctctatatattgagctacgttgaattggagaatctcttgggacacttctcct |
25049621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University