View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21319_low_34 (Length: 284)
Name: NF21319_low_34
Description: NF21319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21319_low_34 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 2 - 277
Target Start/End: Complemental strand, 28341707 - 28341420
Alignment:
| Q |
2 |
gaaaccggttcaggaaccaaacccggttcaggaaattgaactccacaggaacaaaacgaaccgggaggtgcttcttgaaccggatcctcagcagcagcag |
101 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
28341707 |
gaaagcggttcaggaaccaaacccggttcaggaaattgaactccacaggaacaaaacgaaccaggaggagcttctggaaccggatcctcagcagcagcag |
28341608 |
T |
 |
| Q |
102 |
gttc------------atcagtaactaacgaaatcactttctcagcgttttcttcagggcaaacttcaacatcgccgttttctccgtcaacttttgcttc |
189 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| ||||||||||| ||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28341607 |
gttcttcagcaggttcatcagtaactaacgaaatcactttctctgcgttttcttcggggtaaacttcaacatcgccgttttctccgtcaactttcacttc |
28341508 |
T |
 |
| Q |
190 |
ctgttcatccttcacagattccaccttctgaatttcctgaatcttggtttcgacaaccatctccggcccacaattcgtatcctttgct |
277 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28341507 |
ctgttcatccatcacagattccaccttctgaatttcctgaatcttggtttcgacaaccatctccggcccacaattcgtatcctttgct |
28341420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 46 - 160
Target Start/End: Original strand, 28382066 - 28382177
Alignment:
| Q |
46 |
acaggaacaaaacgaaccgggaggtgcttcttgaaccggatcctcagcagcagcaggttcatcagtaactaacgaaatcactttctcagcgttttcttca |
145 |
Q |
| |
|
|||||||||| | |||||||| | |||||||||||||||||||||||| || ||||| ||||||||||| ||||||| | || |||||||||||| |
|
|
| T |
28382066 |
acaggaacaatatgaaccgggttgaacttcttgaaccggatcctcagcagaag---gttcactagtaactaacggaatcactctttccgcgttttcttca |
28382162 |
T |
 |
| Q |
146 |
gggcaaacttcaaca |
160 |
Q |
| |
|
| | |||| |||||| |
|
|
| T |
28382163 |
gaggaaacatcaaca |
28382177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University