View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21319_low_36 (Length: 261)
Name: NF21319_low_36
Description: NF21319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21319_low_36 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 1 - 117
Target Start/End: Complemental strand, 41067413 - 41067297
Alignment:
| Q |
1 |
tcaattttaaccaatttcaactcttgagccactgcagcggcttgttttgaggctgatagagcttgcttagcaagagtaagtgcatcccattggaaaccat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41067413 |
tcaattttaaccaatttcaactcttgagcaactgcagcggcttgttttgaggctgatagagcttgcttagcaagagtaagtgcatcccattggaaaccat |
41067314 |
T |
|
| Q |
101 |
cagcaggcagcatagtt |
117 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
41067313 |
cagcaggcagcatagtt |
41067297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 142 - 244
Target Start/End: Complemental strand, 41067266 - 41067164
Alignment:
| Q |
142 |
acaaaatcctcttccggtgaagaagccaatctgtagtaatcaatatacaaaatctattaaagagacaactttggttgtgcaagcatgagtgctaatcaaa |
241 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41067266 |
acaaaatcctcttcaggtgaagaagccaatctgtagtaatcaatatacaaaatctattaaagagacaactttggttgtgcaagcatgagtgctaatcaaa |
41067167 |
T |
|
| Q |
242 |
tat |
244 |
Q |
| |
|
||| |
|
|
| T |
41067166 |
tat |
41067164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University