View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21319_low_45 (Length: 234)
Name: NF21319_low_45
Description: NF21319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21319_low_45 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 14 - 232
Target Start/End: Complemental strand, 28341922 - 28341704
Alignment:
| Q |
14 |
catactgaccaccattgtaatcaacctcattgacaacaggcacatacgcaaaataaaccggttcaccagttggtccggttaccggcctcattgcttggta |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
28341922 |
catactgaccaccattgtaatcaacctcattgacaacaggcacatacgcgaaataaaccggttcaccaattggtccggttaccggcctcattgcttggta |
28341823 |
T |
|
| Q |
114 |
caatcctgaagatgttggaatcaaataaaccggtaacagttcagttgaataccccatcgagtaataaccatcagcagccaaattgtgcatttctggagta |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28341822 |
caatcctgaagatgttggaatcaaataaaccggtaacagttcagttgaataccccgtcgagtaataaccatcagcagccaaattgtgcatttctggagta |
28341723 |
T |
|
| Q |
214 |
aatgatgactgaaccgaaa |
232 |
Q |
| |
|
|||||||||||||| |||| |
|
|
| T |
28341722 |
aatgatgactgaactgaaa |
28341704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 57 - 234
Target Start/End: Original strand, 28381865 - 28382045
Alignment:
| Q |
57 |
atacgcaaaataaaccggttcaccagttggtccggttaccggcctcattgcttggtacaatcctgaagatgttggaatcaaataaaccggtaacagttca |
156 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| || | ||||||||| ||||| |||||||| |||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
28381865 |
atacgcaaaataaaccggttgaccagttggtccagtaatcggcctcatagcttgatacaatccagaaggtgttggaatcaaataaaccggtaacggttca |
28381964 |
T |
|
| Q |
157 |
gttgaataccccatcgagta---ataaccatcagcagccaaattgtgcatttctggagtaaatgatgactgaaccgaaacc |
234 |
Q |
| |
|
|| |||||||||||| || | |||| || |||| | ||| | |||||||| || ||| |||||||||||||||||| |
|
|
| T |
28381965 |
tttacataccccatcgaataaccagcaccagcaacagcaacattatacatttctgaagcaaaggatgactgaaccgaaacc |
28382045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University