View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21319_low_46 (Length: 231)
Name: NF21319_low_46
Description: NF21319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21319_low_46 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 212
Target Start/End: Complemental strand, 45144237 - 45144026
Alignment:
| Q |
1 |
atctatacaacaacgttgagaggtgttcggaggacatttgaggcttgcaatgcggtgagagcagcttttgatgcatttggtgtacaaatatgcgagcgtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45144237 |
atctatacaacaacgttgagaggtgttcggaggacatttgaggcttgcaatgcggtgagagcagcttttgatgcatttggtgtacaaatatgcgagcgtg |
45144138 |
T |
|
| Q |
101 |
acgtttcgatggatagtgggtttaaagaggaactgagggagcttctgaaagagaagatggtgattccgccgagagtgtttgtgaagggatattatatcgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45144137 |
acgtttcgatggatagtgggtttaaagaggaactgagggagcttctgaaagagaagatggtggttccgccgagagtgtttgtgaagggatattatatcgg |
45144038 |
T |
|
| Q |
201 |
tggtgctgaaga |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
45144037 |
tggtgctgaaga |
45144026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University