View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2131_high_8 (Length: 277)
Name: NF2131_high_8
Description: NF2131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2131_high_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 7 - 267
Target Start/End: Complemental strand, 25036215 - 25035954
Alignment:
| Q |
7 |
atgttcaagatctataaaggatgtgtgtcttccacagcgtaaagacaatttaaggtctttctccactgaccctttgtccccaagaataggttgcatgggt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
25036215 |
atgttcaagatctataaaggatgtgtgtcttccacagtgtaaagacaatttaaggtctttctccaatgaccctttgtccccaagaataggttgcatgggt |
25036116 |
T |
 |
| Q |
107 |
caggtgaagaagaataacaaaatatctggatttccatcttctcatagaatcagtttcattaccaaaagtaacactttctctatgtcatcacctattggaa |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
25036115 |
caggtgaagaagaataacaaaatatctggatttccatcttctcatagaatcagtttcattaccaaaagtaacactttctctatttcatcacctattggaa |
25036016 |
T |
 |
| Q |
207 |
aatattccaaactca-aaaagcttttctctggcaaaaacataagcaccacagcaaccgttac |
267 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||| | |||||||||||||||||||| |
|
|
| T |
25036015 |
aatattccaaactcaaaaaagcttttctctaccaaaaacttgagcaccacagcaaccgttac |
25035954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University