View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2131_low_12 (Length: 251)
Name: NF2131_low_12
Description: NF2131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2131_low_12 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 1 - 136
Target Start/End: Original strand, 33234369 - 33234504
Alignment:
| Q |
1 |
aacaataatggtaatttgtatgtgcacaaactttatgttagaagatcatcttgattatcttttgtttacttgaataataaatttctatcttgtctgcttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33234369 |
aacaataatggtaatttgtatgtgcacaagctttatgttagaagatcatcttgattatcttttgtttacttgaataaaaaatttctatcttgtctgcttt |
33234468 |
T |
|
| Q |
101 |
gcaagaatgtaggataactagtattataggcttgta |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
33234469 |
gcaagaatgtaggataactagtattataggcttgta |
33234504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 152 - 251
Target Start/End: Original strand, 33234488 - 33234584
Alignment:
| Q |
152 |
agtattataggcttctaacatatatgataattatgggtgtgctttaagttttatattattacatacgtgtacttcctctagtcctttgattataatcatt |
251 |
Q |
| |
|
|||||||||||||| ||||||||||| |||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33234488 |
agtattataggcttgtaacatatatgctaat---gtgtgtgctttaagttttatattattacatacgtgtacttcctctagtcctttgattataatcatt |
33234584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University