View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2131_low_13 (Length: 249)
Name: NF2131_low_13
Description: NF2131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2131_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 15 - 240
Target Start/End: Original strand, 40127063 - 40127289
Alignment:
| Q |
15 |
atataccttttggcct-gcaaataattaattgaaaaatccggtgtacctgttctgccattgggctgttcgaggtaacagccgcatgaaacacctcatatt |
113 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40127063 |
atataccttttggccttgcagataattaattgaaaaatccggtgtacctgttctgccatggggctgttcgaggtaacagccgcatgaaacacctcatatt |
40127162 |
T |
|
| Q |
114 |
gcatgtccgtgagcatgcacacaatatcaaacagtaacttaggacgatcttggcttctcacattcaccacccagtaatctctcccctggtatctatctac |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
40127163 |
gcatgtccgtgagcatgcacacaatatcaaacagtaacttaggacgatctcggcttctcacattcaccacccagtaatctctcccctggtatctatccac |
40127262 |
T |
|
| Q |
214 |
cgaaacatgggtcccatcatactgcct |
240 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
40127263 |
cgaaacatgggtcccatcatactgcct |
40127289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University