View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2131_low_9 (Length: 295)
Name: NF2131_low_9
Description: NF2131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2131_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 10 - 278
Target Start/End: Complemental strand, 2158809 - 2158541
Alignment:
| Q |
10 |
gcagagaaagagggagatctgaactctttaaggtggggtcatgaattcttcactggtgaatttgtatgtgagtgtagaattgggttttaacttgtttggc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2158809 |
gcagagaaagagggagatctgaactctttaaggtggggtcatgaattcttcactggtgaatttgtatgtgagtgtagaattgggttttaacttgtttggc |
2158710 |
T |
 |
| Q |
110 |
cttaactttgttcttggtgtgaatcattgtgtatctgttaagagatgttagaattggatacccctttgttcttggcagaatatgcagcatttggttgatg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2158709 |
cttaactttgttcttggtgtgaatcattgtgtatctgttaagagatgttagaattggatacccctttgttcttggcagaatatgcagcatttggttgatg |
2158610 |
T |
 |
| Q |
210 |
tagttaatcatctgaaatctcagaactaatcaacttctctcaattcatggctggaagtcatgtgaactt |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2158609 |
tagttaatcatctgaaatctcagaactaatcaacttctctcaattcatggctggaagtcatgtgaactt |
2158541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University