View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21320_high_10 (Length: 285)
Name: NF21320_high_10
Description: NF21320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21320_high_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 38; Significance: 0.000000000002; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 84 - 141
Target Start/End: Original strand, 29298553 - 29298610
Alignment:
| Q |
84 |
tatatcaactgaataaaaaacaattacttatagactaagttgagttacttgctgtaca |
141 |
Q |
| |
|
|||||||| |||||| ||||||| ||||||||| ||||||||||||||||||| |||| |
|
|
| T |
29298553 |
tatatcaattgaatacaaaacaagtacttataggctaagttgagttacttgctctaca |
29298610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 205 - 234
Target Start/End: Complemental strand, 53611270 - 53611241
Alignment:
| Q |
205 |
atagttggatttatccacaactaactaaca |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
53611270 |
atagttggatttatccacaactaactaaca |
53611241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 241 - 269
Target Start/End: Complemental strand, 4624561 - 4624533
Alignment:
| Q |
241 |
tcattcaagaaataataaattgaggatag |
269 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
4624561 |
tcattcaagaaataataaattgaggatag |
4624533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 14 - 71
Target Start/End: Complemental strand, 53611429 - 53611370
Alignment:
| Q |
14 |
gagatgaaactacaaaggaatgatgaaactc--tattgttaaatgtgagagatatgagtg |
71 |
Q |
| |
|
|||| ||||||||||||||||||| |||||| |||| || ||| ||||||||||||||| |
|
|
| T |
53611429 |
gagaggaaactacaaaggaatgataaaactctttattattgaatttgagagatatgagtg |
53611370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000003; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 19 - 75
Target Start/End: Original strand, 34486393 - 34486451
Alignment:
| Q |
19 |
gaaactacaaaggaatgatgaaactct--attgttaaatgtgagagatatgagtgatat |
75 |
Q |
| |
|
||||||||||| ||||||| ||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
34486393 |
gaaactacaaaagaatgataaaactctttattattaaatgtgagagatatgagtgatat |
34486451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 14 - 75
Target Start/End: Complemental strand, 34391171 - 34391107
Alignment:
| Q |
14 |
gagatgaaactacaaaggaatgatgaaa---ctctattgttaaatgtgagagatatgagtgatat |
75 |
Q |
| |
|
|||| ||||||||||||||||||| ||| || |||| || ||||||||||||||||||||||| |
|
|
| T |
34391171 |
gagaggaaactacaaaggaatgataaaaacactttattattgaatgtgagagatatgagtgatat |
34391107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 205 - 234
Target Start/End: Complemental strand, 28027995 - 28027966
Alignment:
| Q |
205 |
atagttggatttatccacaactaactaaca |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
28027995 |
atagttggatttatccacaactaactaaca |
28027966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 205 - 234
Target Start/End: Complemental strand, 31477996 - 31477967
Alignment:
| Q |
205 |
atagttggatttatccacaactaactaaca |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
31477996 |
atagttggatttatccacaactaactaaca |
31477967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University