View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21320_low_11 (Length: 285)

Name: NF21320_low_11
Description: NF21320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21320_low_11
NF21320_low_11
[»] chr4 (4 HSPs)
chr4 (84-141)||(29298553-29298610)
chr4 (205-234)||(53611241-53611270)
chr4 (241-269)||(4624533-4624561)
chr4 (14-71)||(53611370-53611429)
[»] chr6 (2 HSPs)
chr6 (19-75)||(34486393-34486451)
chr6 (14-75)||(34391107-34391171)
[»] chr2 (1 HSPs)
chr2 (205-234)||(28027966-28027995)
[»] chr1 (1 HSPs)
chr1 (205-234)||(31477967-31477996)


Alignment Details
Target: chr4 (Bit Score: 38; Significance: 0.000000000002; HSPs: 4)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 84 - 141
Target Start/End: Original strand, 29298553 - 29298610
Alignment:
84 tatatcaactgaataaaaaacaattacttatagactaagttgagttacttgctgtaca 141  Q
    |||||||| |||||| ||||||| ||||||||| ||||||||||||||||||| ||||    
29298553 tatatcaattgaatacaaaacaagtacttataggctaagttgagttacttgctctaca 29298610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 205 - 234
Target Start/End: Complemental strand, 53611270 - 53611241
Alignment:
205 atagttggatttatccacaactaactaaca 234  Q
    ||||||||||||||||||||||||||||||    
53611270 atagttggatttatccacaactaactaaca 53611241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 241 - 269
Target Start/End: Complemental strand, 4624561 - 4624533
Alignment:
241 tcattcaagaaataataaattgaggatag 269  Q
    |||||||||||||||||||||||||||||    
4624561 tcattcaagaaataataaattgaggatag 4624533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 14 - 71
Target Start/End: Complemental strand, 53611429 - 53611370
Alignment:
14 gagatgaaactacaaaggaatgatgaaactc--tattgttaaatgtgagagatatgagtg 71  Q
    |||| ||||||||||||||||||| ||||||  |||| || ||| |||||||||||||||    
53611429 gagaggaaactacaaaggaatgataaaactctttattattgaatttgagagatatgagtg 53611370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 36; Significance: 0.00000000003; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 19 - 75
Target Start/End: Original strand, 34486393 - 34486451
Alignment:
19 gaaactacaaaggaatgatgaaactct--attgttaaatgtgagagatatgagtgatat 75  Q
    ||||||||||| ||||||| |||||||  ||| ||||||||||||||||||||||||||    
34486393 gaaactacaaaagaatgataaaactctttattattaaatgtgagagatatgagtgatat 34486451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 14 - 75
Target Start/End: Complemental strand, 34391171 - 34391107
Alignment:
14 gagatgaaactacaaaggaatgatgaaa---ctctattgttaaatgtgagagatatgagtgatat 75  Q
    |||| ||||||||||||||||||| |||   || |||| || |||||||||||||||||||||||    
34391171 gagaggaaactacaaaggaatgataaaaacactttattattgaatgtgagagatatgagtgatat 34391107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 205 - 234
Target Start/End: Complemental strand, 28027995 - 28027966
Alignment:
205 atagttggatttatccacaactaactaaca 234  Q
    ||||||||||||||||||||||||||||||    
28027995 atagttggatttatccacaactaactaaca 28027966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 205 - 234
Target Start/End: Complemental strand, 31477996 - 31477967
Alignment:
205 atagttggatttatccacaactaactaaca 234  Q
    ||||||||||||||||||||||||||||||    
31477996 atagttggatttatccacaactaactaaca 31477967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University