View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21321_high_29 (Length: 238)
Name: NF21321_high_29
Description: NF21321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21321_high_29 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 66 - 238
Target Start/End: Complemental strand, 22756863 - 22756691
Alignment:
| Q |
66 |
ttgttccatgtgtccttgaggaaaatagaaaactctttgtccagcacgaggaacttcaacatgaggaccagcacaagccttccataactgttcatagagt |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22756863 |
ttgttccatgtgtccttgaggaaaatagaaaactctttgtccagcacgaggaacttcaacatgaggaccagcacaagccttccataactgttcatagagt |
22756764 |
T |
 |
| Q |
166 |
tcatcttcttcaccattattcatcatcattgcaagtcaaaaaccttttcactttttcaccactttgatcaaat |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22756763 |
tcatcttcttcaccattattcatcatcattgcaagtcaaaaaccttttcactttttcaccactttgatcaaat |
22756691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 66 - 125
Target Start/End: Original strand, 7077583 - 7077642
Alignment:
| Q |
66 |
ttgttccatgtgtccttgaggaaaatagaaaactctttgtccagcacgaggaacttcaac |
125 |
Q |
| |
|
|||||||||||||||||| || ||||||||||| ||||| ||| ||| |||||| ||||| |
|
|
| T |
7077583 |
ttgttccatgtgtccttgtgggaaatagaaaacactttgaccaacacaaggaacatcaac |
7077642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University