View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21321_low_15 (Length: 339)
Name: NF21321_low_15
Description: NF21321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21321_low_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 1 - 329
Target Start/End: Original strand, 42222792 - 42223121
Alignment:
| Q |
1 |
cttgtatctcagtcacactgtgggatgtggattctagcatttgtaactctaattagaaagcaaaattctagtttggttttatgactttgtctttcgctcg |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
42222792 |
cttgtatctcagtcacactgtggcatgtggattctagcctttgtaactctaattagaaagcaaaattctagtttggttttatgactttatctttcgctcg |
42222891 |
T |
 |
| Q |
101 |
tactttggagtggtcttctttt-ggcgaagggagttgcattgtggtcttctagtttggcttttcctctatttgagatttattgactactttagtttacat |
199 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
42222892 |
tactttggagtggtcttctttttggcgaagggagttgcattgtggtcttctagtttggcttttcctctattcgagatttattgactactttagtttacat |
42222991 |
T |
 |
| Q |
200 |
gttattgcgcaggtgaacgtttaagcccttgggtggccgctggatgttttacaatgggcatatcaattctattcttctgaaccttactctgacttgaaat |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42222992 |
gttattgcgcaggtgaacgtttaagcccttgggtggccgttggatgttttacaatgggcgtatcaattctattcttctgaaccttactctgacttgaaat |
42223091 |
T |
 |
| Q |
300 |
ggttccattttcctttccattcttctcact |
329 |
Q |
| |
|
| |||||||||||||||||||||| ||||| |
|
|
| T |
42223092 |
gtttccattttcctttccattcttttcact |
42223121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University