View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21321_low_19 (Length: 290)
Name: NF21321_low_19
Description: NF21321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21321_low_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 1 - 280
Target Start/End: Complemental strand, 22756631 - 22756352
Alignment:
| Q |
1 |
caattgaaagatgaatgattaagctttatgagagacaatataaacagcttttgaaatcatgtctgttatgaaagctgctgcaaacgttacagaacctttc |
100 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22756631 |
caattgaatgatgaatgattaagctttatgagagacaatataagctgcttttgaaatcatgtctgttatgaaagctgctgcaaacgttacagaacctttc |
22756532 |
T |
 |
| Q |
101 |
agacagaaacacactctctctcttttgtaaggaaacggcgtttgttggaatctgtgaatcacaatacataacagcttctttggtttgtgtccattttata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22756531 |
agacagaaacacactctctctcttttgtaaggaaacggcgtttgttggaatctgtgaatcacaatacataacagcttctttggtttgtgtccattttata |
22756432 |
T |
 |
| Q |
201 |
atacaaaagactatgtcttcttccttcttttgtttttcaatattttattcttagtgttgtgtcacaactatgtgtctctg |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
22756431 |
atacaaaagactatgtcttcttccttcttttgttttacaatattttattcttagtgttgtgtcacaactatgtgtttctg |
22756352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University