View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21321_low_21 (Length: 278)

Name: NF21321_low_21
Description: NF21321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21321_low_21
NF21321_low_21
[»] chr1 (1 HSPs)
chr1 (1-254)||(44108072-44108341)


Alignment Details
Target: chr1 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 1 - 254
Target Start/End: Complemental strand, 44108341 - 44108072
Alignment:
1 agaaaaattgaatgatttgaaggatgaataaccaaaagaactgatcgagaacaacaatagatgaataagcaaaatgaaagaaattgaa-gcaaaaga--- 96  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||| |||||||||| ||||||  ||||||||||| ||||||||       
44108341 agaaaaattgaatgatttgaaggatgaataagcaaaagaactgatcgagaagaacaacagatgaataaccaaaattcaagaaattgaacgcaaaagaaat 44108242  T
97 -----------tgaatgtgtttgggggaaattagattttcaaatgacaatattatattaacaattgtataataaccgattgagattcgagaacaacaaca 185  Q
               |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
44108241 taaagcatagatgaatgtgtttgggggaaattagattttgaaatgacaatattatattaacaattgtataataaccaattgagattcgagaacaacaaca 44108142  T
186 caatcgaagcacaaaaattagaa-aaatattaagaacaaaaattgaatcatttgaaaactgcagaagaac 254  Q
    |||||| |||||| ||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||    
44108141 caatcgtagcacagaaattagaataaaaattaagaacaaaaattgaatcatttgaaaactgcagaagaac 44108072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University