View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21321_low_23 (Length: 261)
Name: NF21321_low_23
Description: NF21321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21321_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 99; Significance: 6e-49; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 1 - 137
Target Start/End: Original strand, 38470177 - 38470316
Alignment:
| Q |
1 |
atcttcttattctattatttgttttgttcttttttaacaatgaaacaaattaaaaatgaaaagttggataaaattgattcgctttgta---nnnnnnnnn |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38470177 |
atcttcttattctattatttgttttgttcttttttaacaatgaaacaaattaaaaatgaaaagttggataaaattgattcgctttgtatttatttttttt |
38470276 |
T |
 |
| Q |
98 |
ctttcaaatgttggacatattaattggtgaaaccgtggag |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38470277 |
ctttcaaatgttggacatattaattggtgaaaccgtggag |
38470316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 194 - 239
Target Start/End: Original strand, 38470373 - 38470418
Alignment:
| Q |
194 |
atatggagcatttgtggcctattaaaatttctcaatgtgatatatg |
239 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38470373 |
atatgaagcatttgtggcctattaaaatttctcaatgtgatatatg |
38470418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University