View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21321_low_37 (Length: 221)
Name: NF21321_low_37
Description: NF21321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21321_low_37 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 7e-82; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 27 - 205
Target Start/End: Original strand, 31707408 - 31707586
Alignment:
| Q |
27 |
agtgtttctgtgagaaacnnnnnnntgtcttctaaaccgaaaaaacaaacatacagcgtatgtttctgctgccggcgccggtttaaactcggcgtatcag |
126 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31707408 |
agtgtttctgtgagaaacaaaaaaatgtcttctaaaccgaaaaaacaaacatacagcgtatgtttctgctgccggcgccggtttaaactcggcgtatcag |
31707507 |
T |
 |
| Q |
127 |
aggcaccgccggaaataaaagagctttacgatcgttactccgatgaaggcgggatcatgacagcatcccacctgagaag |
205 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31707508 |
aggcaccgccggaaataaaagagctttaccatcgttactccgatgaaggcgggatcatgacagcatcccacctgagaag |
31707586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 118 - 205
Target Start/End: Complemental strand, 31013853 - 31013766
Alignment:
| Q |
118 |
gcgtatcagaggcaccgccggaaataaaagagctttacgatcgttactccgatgaaggcgggatcatgacagcatcccacctgagaag |
205 |
Q |
| |
|
||||||| |||||||||||||| ||||||||| |||| ||||||||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
31013853 |
gcgtatcggaggcaccgccggagataaaagagatttatcatcgttactccgatgaaggcgggatcatgacagcatctcacctcagaag |
31013766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University