View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21321_low_41 (Length: 206)
Name: NF21321_low_41
Description: NF21321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21321_low_41 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 4395070 - 4395274
Alignment:
| Q |
1 |
agatgtaggaaagaaaatgctggagagtg--atgaggttttaatgtatggtgttttatttggttgttgtctattttgatgacttgctgatttcttctttc |
98 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
4395070 |
agatgtaggaaagaaaatgctggagagtgtgatgaggttttaatgtatggtattttatttggttgttgtctattttgatgacttgctgattttttctttc |
4395169 |
T |
 |
| Q |
99 |
tgttatattatgtcattgtactattgtgtttgctattagggttattattcaatagaggtttatagaagaacactgctcatgagaatgacttcagatatct |
198 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4395170 |
tgttatattatgtcaatgtactattgtgtttgctattagggttattattcaatagaggtttatagaagaacactgctcatgagaatgacttcagatatct |
4395269 |
T |
 |
| Q |
199 |
gtgct |
203 |
Q |
| |
|
||||| |
|
|
| T |
4395270 |
gtgct |
4395274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University