View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21322_high_5 (Length: 312)
Name: NF21322_high_5
Description: NF21322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21322_high_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 255
Target Start/End: Original strand, 9561245 - 9561485
Alignment:
| Q |
18 |
aagaacaggttagtaaattttaaatctgcgacagtgacattggaatgnnnnnnnttatgtttgttttggcctttttaagcactgggacgattgttttttc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9561245 |
aagaacaggttagtaaattttaaatctgcgacagtgacattggaatgaaaaaaattatgtttgttttggcctttttaagcactgggacgattgttttttc |
9561344 |
T |
|
| Q |
118 |
tggcaggattattagtagcaaactgtttaattgttttccatactattttgc---ttagttatttccgatagatgaatgatgttctatcaagtggttgttg |
214 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9561345 |
tggcagggttattagtagcaaactgtttaattgttttccatactattttgcttgttagttatttccgatagatgaatgatgttctatcaagtggttgttg |
9561444 |
T |
|
| Q |
215 |
gtattgcaagatgatagtaggttaggtccatacttcataaa |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9561445 |
gtattgcaagatgatagtaggttaggtccatacttcataaa |
9561485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 276 - 311
Target Start/End: Original strand, 9561506 - 9561541
Alignment:
| Q |
276 |
caatttgtcaggagttattccatgttaagatatatt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
9561506 |
caatttgtcaggagttattccatgttaagatatatt |
9561541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University