View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21322_high_6 (Length: 279)
Name: NF21322_high_6
Description: NF21322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21322_high_6 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 279
Target Start/End: Complemental strand, 43928683 - 43928404
Alignment:
| Q |
1 |
cttgtgcggatattcttgcatagttgggagctaactatgtggactctttgatt-attgttaatgaatttttcctagtttgtcttggacgcttctagcgga |
99 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43928683 |
cttgtgtggatattcttgcatagttgggagctaactatgtggactctttgatttattgttaatgaatttttcctagtttgtcttggacgcttctagcgga |
43928584 |
T |
 |
| Q |
100 |
cagtgtccttttttaagacttagttttagttcnnnnnnnnctcttctctctcatgtaaccaaaaaagaagggtttatatttatttaataaataaattgaa |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43928583 |
cagtgtccttttttaagacttagttttagttcttttttttttcttctctctcatgtaaccaaaaaagaagggtttatatttatttaataaataaattgaa |
43928484 |
T |
 |
| Q |
200 |
atgtgggaatgccatgtggcattgggagttagaggaaggggaaaaatgacaaagcagaggatcacagaccgttgcaggtt |
279 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43928483 |
atatgggaatgccatgtggcattgggagttagaggaagggggaaaatgacaaagcagaggatcacagaccgttgcaggtt |
43928404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University