View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21323_high_18 (Length: 243)
Name: NF21323_high_18
Description: NF21323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21323_high_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 11 - 222
Target Start/End: Original strand, 37698000 - 37698212
Alignment:
| Q |
11 |
gtgagatgaactaatttacttttaggaaaggtagagagtttgtacacattgatccatttgagtgaggagttacctgttgctttcaggatgctgaataaag |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37698000 |
gtgagatgaactaatttacttttaggaaaggtagagagtttgtacacattgatccatttgagtgaggagttacctgttgctttcaggatgctgaataaag |
37698099 |
T |
 |
| Q |
111 |
agttacatctaacatgaaggagcgtataaaaatcacc-nnnnnnnactttctgagcagcatgttttttcttttgaaacctctgcagcatgttgtttgttc |
209 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37698100 |
agttacatctaacatgatggagcgtataaaaatcaccttttttttactttctgagcagcatgttttttcttttgaaacctctgcagcatgttgtttgttc |
37698199 |
T |
 |
| Q |
210 |
tactataaacgac |
222 |
Q |
| |
|
||||||||||||| |
|
|
| T |
37698200 |
tactataaacgac |
37698212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University