View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21323_high_21 (Length: 206)
Name: NF21323_high_21
Description: NF21323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21323_high_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 24 - 155
Target Start/End: Complemental strand, 25536050 - 25535919
Alignment:
| Q |
24 |
agaaagtaccgtgttaagacgattgtgctggtagtatataagaaaaaagatgctagagtatgtatcattttcatttaccaaaatcagaagttagttcgaa |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25536050 |
agaaagtaccgtgttaagacgattgtgctggtagtatataagaaaaaagatgctagagtttgtatcattttcatttaccaaaatcagaagttagttcgaa |
25535951 |
T |
|
| Q |
124 |
atcttagggtttcattcaattcaacaatgtca |
155 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |
|
|
| T |
25535950 |
atcttagggtttcattcaactcaacaatgtca |
25535919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University