View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21323_low_15 (Length: 314)
Name: NF21323_low_15
Description: NF21323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21323_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 105; Significance: 2e-52; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 146 - 298
Target Start/End: Complemental strand, 45471644 - 45471490
Alignment:
| Q |
146 |
ccacaaaccattctcatgtgtgaacatgacctatatctacttttcatttccttcnnnnnnnnn--tctaattttcatgtttcaatgaaaatgacttgttc |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| | || |||||||||||||||||||||||||||||||| |
|
|
| T |
45471644 |
ccacaaaccattctcatgtgtgaacatgacctatatctacttttcatttcccttaaaaaaaaaaatccaattttcatgtttcaatgaaaatgacttgttc |
45471545 |
T |
|
| Q |
244 |
ggttaattatcgttgatctttgatcatatgtggtggacttttatataattattat |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45471544 |
ggttaattatcgttgatctttgatcatatgtggtggacttttatataattattat |
45471490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University