View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21323_low_17 (Length: 256)
Name: NF21323_low_17
Description: NF21323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21323_low_17 |
 |  |
|
| [»] scaffold0028 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 67; Significance: 7e-30; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 10 - 84
Target Start/End: Complemental strand, 22080416 - 22080342
Alignment:
| Q |
10 |
aaataaattaccatgtacaggtttggttgtttctgatgagtttttgttcttcccatgtttagaatttatagtttg |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
22080416 |
aaataaattaccatgtacaggtttggttgtttctgaggagtttttgttcttcacatgtttagaatttatagtttg |
22080342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 184 - 238
Target Start/End: Complemental strand, 22079927 - 22079873
Alignment:
| Q |
184 |
tgttgcaaattcaaagaacaaacaacatattgagatggtgttgtgtgacaaagag |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22079927 |
tgttgcaaattcaaagaacaaacaacatattgagatggtgttgtgtgacaaagag |
22079873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 81 - 144
Target Start/End: Complemental strand, 22080239 - 22080176
Alignment:
| Q |
81 |
tttgagttgtgtgtctaacattatgtttttgtcagcatttttagttgtgtctgcatatttttta |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
22080239 |
tttgagttgtgtgtctaacattatgtttttgtcataatttttagttgtgttagcatatttttta |
22080176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 134 - 188
Target Start/End: Original strand, 22079786 - 22079840
Alignment:
| Q |
134 |
catattttttaaaacattagtttctattaaaattaattatagatcagtgatgttg |
188 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
22079786 |
catactttttaaaacattagtttctattaaaattaattatagatgagtgatgttg |
22079840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 47; Significance: 6e-18; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 1522626 - 1522680
Alignment:
| Q |
184 |
tgttgcaaattcaaagaacaaacaacatattgagatggtgttgtgtgacaaagag |
238 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1522626 |
tgttgcaaattcaaagaagaaacagcatattgagatggtgttgtgtgacaaagag |
1522680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 81 - 114
Target Start/End: Original strand, 1522417 - 1522450
Alignment:
| Q |
81 |
tttgagttgtgtgtctaacattatgtttttgtca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
1522417 |
tttgagttgtgtgtctaacattatgtttttgtca |
1522450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 191 - 238
Target Start/End: Complemental strand, 23700219 - 23700172
Alignment:
| Q |
191 |
aattcaaagaacaaacaacatattgagatggtgttgtgtgacaaagag |
238 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23700219 |
aattcaaagagcaaacaacatattgagatggtgttgtgtgacaaagag |
23700172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 184 - 238
Target Start/End: Complemental strand, 125062 - 125008
Alignment:
| Q |
184 |
tgttgcaaattcaaagaacaaacaacatattgagatggtgttgtgtgacaaagag |
238 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
125062 |
tgttggaaattcaaagaacaaacaacatattgagatggtggggtgcgacaaagag |
125008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University