View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21324_high_14 (Length: 264)
Name: NF21324_high_14
Description: NF21324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21324_high_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 250
Target Start/End: Original strand, 46632117 - 46632366
Alignment:
| Q |
1 |
cataggtcacgggaattaacaaacttattcttaaaactcaaannnnnnngtttaagtaaacttaaaactcaattagtgcctagaaaattgcttcttttgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| | || |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46632117 |
cataggtcacgggaattaacaaacttattcttaaaactcaattttttttgcttgagtaaacttaaaactcaattagtgcctagaaaattgcttcttttgt |
46632216 |
T |
|
| Q |
101 |
gtgttgtaaaatccaaagtaaaacatgttacattataaaattgtttagtctatccaaatgaggaacaatatgaagtagttatagtcatgaaattcggttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
46632217 |
gtgttgtaaaatccaaagtaaaacatgttacattataaaattgtttagtctatccaaatgaggaacaatatgaagtagttctagtcatgaaattcggttt |
46632316 |
T |
|
| Q |
201 |
tgtgcatgtaggaaatggacagaggcttggaagacaacatcaaaattgtg |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46632317 |
tgtgcatgtaggaaatggacagaggcttggaagacaacatcaaaattgtg |
46632366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University