View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21324_high_15 (Length: 250)
Name: NF21324_high_15
Description: NF21324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21324_high_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 46631807 - 46631566
Alignment:
| Q |
1 |
tcatgtttatgacatcaattcagaaaatttcaacaatcaaattcaaattggtaagaaaagataattattaattagtagtagtaagagaactaacattata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46631807 |
tcatgtttatgacatcaattcagaaaatttcaacaatcaaattcaaattggtaagaaaagataattattaattagtagtagtaagagaactaacattata |
46631708 |
T |
|
| Q |
101 |
tatttgcctgaacaagtcattttccatagcatttctgtgatttagatgaggctttccttctgacaccattcggatcctttgagcacgagctctagcttgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46631707 |
tatttgcctgaacaagtcattttccatagcatttctgtgatttagatgaggctttccttctgacaccattcggatcctttgagcacgagctctagcttgt |
46631608 |
T |
|
| Q |
201 |
gctgtgaccagagcctgcatacatctgagtgttgcctatgct |
242 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||| |||| |
|
|
| T |
46631607 |
gctgtgaccagatcttgcatacatctgagtgttgcctttgct |
46631566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 232
Target Start/End: Complemental strand, 15505904 - 15505848
Alignment:
| Q |
176 |
cctttgagcacgagctctagcttgtgctgtgaccagagcctgcatacatctgagtgt |
232 |
Q |
| |
|
||||||||||| |||||| ||||||||| |||||| ||| ||||| ||||| ||||| |
|
|
| T |
15505904 |
cctttgagcacaagctcttgcttgtgctatgaccaaagcttgcatgcatcttagtgt |
15505848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University