View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21325_low_8 (Length: 304)
Name: NF21325_low_8
Description: NF21325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21325_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 6 - 285
Target Start/End: Complemental strand, 35745628 - 35745331
Alignment:
| Q |
6 |
agtgagatgaataacattgaaagacaagacatgcagaagatgttggaagtctagcattacctatctatctgagatatcctaggcactattaattgatatt |
105 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35745628 |
agtgacatgaataacattgaaagacaagacatgcagaagatgttggaagcttagcattacctatctatctgagatatcctaggcactattaattgatatt |
35745529 |
T |
 |
| Q |
106 |
atataagcacttgcagggactgaaagtgataaaaggctctagcacacctaagaag------------------tcttcaaaggctcagagcaaagaaaat |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
35745528 |
atataagcacttgcagggactgaaagtgataaaaggctctagcacacctaagaagtcttgcacacctaagaagtcttcaaaggctcagagcaaagaaaat |
35745429 |
T |
 |
| Q |
188 |
ggagagtcaatggagttatcattcgtaggagcagaccaattgattttaatggtagagattcatacgaagatcatggcattcagagatatcatggactt |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
35745428 |
ggagagtcaatggagttatcattcgtaggagcagaccaattgattttaatggtagagattcatatgaagatcatggcattcagagatatcatggactt |
35745331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University