View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21326_high_36 (Length: 209)
Name: NF21326_high_36
Description: NF21326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21326_high_36 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 22 - 196
Target Start/End: Complemental strand, 32532122 - 32531947
Alignment:
| Q |
22 |
aggtcattattgacacacgtgctattggggatagtaagggccctacaactctttctgtcaattttttatgacagtttctgctaattattttagagccata |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32532122 |
aggtcattattgacacacgtgctattggggatggtaagggccctacaactctttctgtcaattttttatgacagtttctgctaattattttagagccata |
32532023 |
T |
|
| Q |
122 |
atgatggatatcagattttgggacccacagaacacagatagag-aacataacatagaacaatcagattcctccaca |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32532022 |
atgatggatatcagattttgggacccacagaacacaaagagagaaacataacatagaacaatcagattcctccaca |
32531947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University