View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21326_low_11 (Length: 368)
Name: NF21326_low_11
Description: NF21326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21326_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 333; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 333; E-Value: 0
Query Start/End: Original strand, 1 - 363
Target Start/End: Complemental strand, 45541329 - 45540970
Alignment:
| Q |
1 |
tttgcttcagttaccttcaaaccttcttcgtgaagttcggcagttcccttgcttatagcgttgaatttattcacaggtactggaggttgatgatttggcg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45541329 |
tttgcttcagttaccttcaaaccttcttcgtgaagttcggcagttcccttgctaatagcgttgaatttattcacaggtactggaggttgatgatttggcg |
45541230 |
T |
|
| Q |
101 |
aagcaatatgctgatcggacatatatacatcaccagacttatctaaatcagaagaagatttgaagcaagctagttcacttgagaaacttgtatttcccat |
200 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45541229 |
aagcaatatactgatcggacatacatacatcaccagacttatctaaatcagaaga---tttgaagcaagctagttcacttgagaaacttgtatttcccat |
45541133 |
T |
|
| Q |
201 |
ataaatgctgaagagtgattcgttagaggcagtgctccattctactggggcatttgtattgtttctagcaaatacatgagatggaaagacatattgggca |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45541132 |
ataaatgctgaagagtgattcgttagaggcagtgctccattctactggggcatttgtattgtttctagcaaatacatgagatggaaagacatattgggca |
45541033 |
T |
|
| Q |
301 |
ttagtcacattttcacttggacgctccatcaattgtatcggcgggttttgtatctctgctcct |
363 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45541032 |
ttagtcacattttcacttggacgctccatcaattgtatcggcgggttttgtatctctggtcct |
45540970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University