View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21326_low_20 (Length: 293)
Name: NF21326_low_20
Description: NF21326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21326_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 4e-87; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 17 - 190
Target Start/End: Complemental strand, 41980748 - 41980577
Alignment:
| Q |
17 |
atgaaaccggaggaaatcatcaattacaaccaatgtgaacaatatatatagcaatcatataaagttcatttcttcccatgctttctttcttgcttcctct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41980748 |
atgaaaccggaggaaatcatcaattacaaccaatgtgaacaatatata--gcaatcatataaagttcatttcttcccatgctttctttcttgcttcctct |
41980651 |
T |
|
| Q |
117 |
tccaattcaccaaacgttggagaaatctcataacctacacgtatataattataattcgtaattataatcttgct |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41980650 |
tccaattcaccaaacgttggagaaatctcataacctacacgtatataattataattcgtaattataatcttgct |
41980577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 226 - 278
Target Start/End: Complemental strand, 41980492 - 41980440
Alignment:
| Q |
226 |
catgcaaagagtattgggatttaaacctcagaggtgtctcggagagagtataa |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41980492 |
catgcaaagagtattgggatttaaacctcagaggtgtctcggagagagtataa |
41980440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University