View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21326_low_25 (Length: 270)

Name: NF21326_low_25
Description: NF21326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21326_low_25
NF21326_low_25
[»] chr4 (2 HSPs)
chr4 (10-157)||(39231897-39232045)
chr4 (220-252)||(39231802-39231834)


Alignment Details
Target: chr4 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 10 - 157
Target Start/End: Complemental strand, 39232045 - 39231897
Alignment:
10 cgaagaatatttactgagaaaaat-taatttttaactttttatattgtgaaattaatttcttaacttggaaaacaaaacatagtcaattgaaatttgaaa 108  Q
    |||| ||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
39232045 cgaataatatttactgagaaaaaaataatttttaactttttatattgtgaaattaatttcttaacttggaaaacaaaacacagtcaattgaaatttgaaa 39231946  T
109 ggttgtattcattcattcaacaaactacaattttcattgccgtcgaatg 157  Q
    ||||| ||||||||||| |||||| |||||||||||||||| |||||||    
39231945 ggttgaattcattcattgaacaaattacaattttcattgccttcgaatg 39231897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 220 - 252
Target Start/End: Complemental strand, 39231834 - 39231802
Alignment:
220 ggagagtaaaatagatgatgataaatacccaaa 252  Q
    |||||||||||| ||||||||||||||||||||    
39231834 ggagagtaaaatggatgatgataaatacccaaa 39231802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University