View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21326_low_26 (Length: 269)
Name: NF21326_low_26
Description: NF21326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21326_low_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 48; Significance: 2e-18; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 4 - 51
Target Start/End: Complemental strand, 30381588 - 30381541
Alignment:
| Q |
4 |
tggcggggtccgaggaaaccgcaccgaatattgacaatcttttaattc |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30381588 |
tggcggggtccgaggaaaccgcaccgaatattgacaatcttttaattc |
30381541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 186 - 230
Target Start/End: Complemental strand, 30381498 - 30381454
Alignment:
| Q |
186 |
tatttatttatgggattctagaactgctcttttattggttcttca |
230 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
30381498 |
tatttatttatgggattctagaactcctcttttattggttcttca |
30381454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University