View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21326_low_32 (Length: 238)
Name: NF21326_low_32
Description: NF21326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21326_low_32 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 27 - 238
Target Start/End: Original strand, 31111636 - 31111847
Alignment:
| Q |
27 |
tctttaaactttagccattcgtcctcaacaatttccatcgccttttctctacaagaacgtgcaaagcaaaaatcaccaagcataattctttcagcactca |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31111636 |
tctttaaactttagccattcgtcctcaacaatttccatcgccttttctctacaagaacgtgcaaagcaaaaatcaccaagcataattctttcagcactca |
31111735 |
T |
 |
| Q |
127 |
gtagcacagttagacgtccttaatgtgatgggtgtgctcacagacattgtcaacctactccaacaatagaatgcgtgtctcgctcaagtagaagaaaatc |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
31111736 |
gtagcacagttagacgtccttaatgtgatgggtgtgctcacaaacattgtcaacctactccaacaatagaatgcgtgtctcactcaagtagaagaaaatc |
31111835 |
T |
 |
| Q |
227 |
aatataaaattt |
238 |
Q |
| |
|
|||||||||||| |
|
|
| T |
31111836 |
aatataaaattt |
31111847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University